View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1641-INSERTION-7 (Length: 359)
Name: NF1641-INSERTION-7
Description: NF1641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1641-INSERTION-7 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 329; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 329; E-Value: 0
Query Start/End: Original strand, 8 - 359
Target Start/End: Complemental strand, 7266351 - 7265999
Alignment:
| Q |
8 |
gtttttaagtctttgcatttgtaccggacacatttgatcgtacttcgatataatatcaagaattgtgaccgcaagtaaaatataaaataatatcataatc |
107 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
7266351 |
gtttttaagtctttgcatttgcaccggacacatttgatcgtacttcgatataatatcaagaattgtgaccgcaagtaaaacataaaataatatcataatc |
7266252 |
T |
 |
| Q |
108 |
atgtatctaagtcttcctgaatacactttcttaatttgccaacaacttttgatagaaaaaa-tagattcatttcataaggaattaattcttattcttagt |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7266251 |
atgtatctaagtcttcctgaatacactttcttaatttgccaacaacttttgatagaaaaaaatagattcatttcataaggaattaattcttattcttagt |
7266152 |
T |
 |
| Q |
207 |
atataaaatcatgtatctttttgttgagctattttgtagtatatattgctttgcatttgttaaatttgctttggattcttttgcatgcatatgtcaagga |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7266151 |
atataaaatcatgtatctttttgttgagctattttgtagtatatattgctttccatttgttaaatttgctttggattcttttgcatgcatatgtcaagga |
7266052 |
T |
 |
| Q |
307 |
gctgaaaaatttctcttcattatacttttaacgacagggctgcgatgcatcaa |
359 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
7266051 |
gctgaaaaatttctcttcattgtacttttaacgacagggctgcgatgcatcaa |
7265999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University