View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16410_low_11 (Length: 380)
Name: NF16410_low_11
Description: NF16410
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16410_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 1 - 364
Target Start/End: Original strand, 40415916 - 40416279
Alignment:
| Q |
1 |
tataccatgaaatttaagattttatatnnnnnnntgagaccatcaaagatagttgggatgaattgttccagagaaattaagttcgaattctggttgaaac |
100 |
Q |
| |
|
|||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
40415916 |
tatatcatgaaatttaagattttatataaaaaaatgagaccatcaaagatagttgggatgaattgttccagagaaattaagtttgaattctggttgaaac |
40416015 |
T |
 |
| Q |
101 |
aatcttaattaaactttatttacctcccgagttctatattcactaaaatcccattccccttaaaaccggatggtttagataagtggttcttttgttctcg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40416016 |
aatcttaattaaactttatttacctcccgaattctatattcactaaaatcccattcccctgaaaaccggatggtttagataagtggttcttttgttctcg |
40416115 |
T |
 |
| Q |
201 |
nnnnnnnnnnnnnnnnnnnnnnngcgtaaaaaacaatgtaaagactatggcagtcactaacaagttcatttgaattgggagatcgtgcaagctcactttc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40416116 |
ttttttgatatattttttcttttgcgtaaaaaacaatgtaaagactatggcagtcactaaccagttcatttgaattgggagatcgtgcaagctcactttc |
40416215 |
T |
 |
| Q |
301 |
ttgtgctggttcaacataagcagcatttgtgctcataccaagagttattgaagccacattgtct |
364 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
40416216 |
ttgtgctggttcaacataagcagcatttgtgctcataccaagagttattgcagccacattgtct |
40416279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University