View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16412_low_3 (Length: 244)
Name: NF16412_low_3
Description: NF16412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16412_low_3 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 4 - 220
Target Start/End: Complemental strand, 38734135 - 38733919
Alignment:
| Q |
4 |
gtaacatgatttttcttaccgagacaagaaagtgcctttggtgtttgcgaaaactaaaatgctatcaagaacaagtgagtattacataagacaaatgttg |
103 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
38734135 |
gtaacatgatttttcttaccgagataagaaagtgcctttggtgtttgcgaaaactaaaatgctatcaagaacaagtgagtattacataagacaaatgctg |
38734036 |
T |
|
| Q |
104 |
atatcttatcgacaatctaagatacataagatttgaaataaaatcaccgaagaaaaaattaggataagactacagcgtacgtgaatcttcatcttgttta |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
38734035 |
atatcttatcgacaatctaagatacataagatttgaaataaaatcaccgaagaaaaaattaggataacactacagtgtacgtgaatcttcatcttgttta |
38733936 |
T |
|
| Q |
204 |
tgttctggttctgcaat |
220 |
Q |
| |
|
|||||||||||| |||| |
|
|
| T |
38733935 |
tgttctggttctccaat |
38733919 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University