View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16414_high_11 (Length: 316)
Name: NF16414_high_11
Description: NF16414
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16414_high_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 135; Significance: 2e-70; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 19 - 177
Target Start/End: Complemental strand, 12364973 - 12364815
Alignment:
| Q |
19 |
gagctggtaatggttttaccatgaggattaacgaaaatgtgtgagtgttggtaatgatctggacaagtttcattggtctggaaagtaaatcagggattat |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
12364973 |
gagctggtaatggttttaccatgaggattaacggaaatgtgtgagtgttggtaatgatctggacaggtttcattggtctggaaagtaaatcagggattaa |
12364874 |
T |
|
| Q |
119 |
gtttcgatttcctttgatatgttttacagtgaaatcatacctcgaaaaccaatctttga |
177 |
Q |
| |
|
|||| ||||| ||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
12364873 |
gttttgatttactttgatatgttttacagtaaaatcatacctcgaaaaccaatctttga |
12364815 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 212 - 275
Target Start/End: Complemental strand, 12364819 - 12364756
Alignment:
| Q |
212 |
tttgaattcaagaatttttggaaaggaagaattatccatctgaacttcaaaatgataatgtaac |
275 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12364819 |
tttgaattcaagaatttttagaaaggaagaattatccatctgaacttcaaaatgataatgtaac |
12364756 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University