View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16414_low_10 (Length: 365)
Name: NF16414_low_10
Description: NF16414
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16414_low_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 243; Significance: 1e-134; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 243; E-Value: 1e-134
Query Start/End: Original strand, 79 - 321
Target Start/End: Complemental strand, 38070428 - 38070186
Alignment:
| Q |
79 |
cagcaccttacctactaccatacttctcacttatggtcttcatccagtacccttctacttctgtcactctacttctagcttctacttgtaccttctctaa |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38070428 |
cagcaccttacctactaccatacttctcacttatggtcttcatccagtacccttctacttctgtcactctacttctagcttctacttgtaccttctctaa |
38070329 |
T |
 |
| Q |
179 |
gcacattcacttgtttcttcagattcataacttcttttcttctcagagctttttcctttacagcagaaacttacttgtatagtatatatccttcattgtt |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38070328 |
gcacattcacttgtttcttcagattcataacttcttttcttctcagagctttttcctttacagcagaaacttacttgtatagtatatatccttcattgtt |
38070229 |
T |
 |
| Q |
279 |
catttgtaatgcttggcaattaagaggtaagaatgtgtaatta |
321 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38070228 |
catttgtaatgcttggcaattaagaggtaagaatgtgtaatta |
38070186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University