View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16414_low_17 (Length: 265)
Name: NF16414_low_17
Description: NF16414
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16414_low_17 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 20 - 253
Target Start/End: Complemental strand, 49302068 - 49301835
Alignment:
| Q |
20 |
aggttcacatagtgattgaactatatctgaacttccacattcccttctatattctagtgtgataccagataattggtgactctctagaatttggtctgga |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49302068 |
aggttcacatagtgattgaactatatctgaacttccacattcccttctatattctagtgtgataccagataattggtgactctctagaatttggtctgga |
49301969 |
T |
|
| Q |
120 |
atggtctgtaaaataatcaataatnnnnnnnntgaaagttaactatttgattatattctaataatggtataaatattgaagaatgataatgagtatatta |
219 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49301968 |
atggtctgtaaaataatcaataataaaaaaaatgaaagttaactatttgattatattctaataatggtataaatattgaagaatgataatgagtatatta |
49301869 |
T |
|
| Q |
220 |
atattgttttgaatttacctctagcatccacctt |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
49301868 |
atattgttttgaatttacctctagcatccacctt |
49301835 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University