View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16416_high_24 (Length: 228)
Name: NF16416_high_24
Description: NF16416
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16416_high_24 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 211
Target Start/End: Complemental strand, 11022410 - 11022200
Alignment:
| Q |
1 |
aaataccggaaaaactaggacaaggatgaattgttcttatctcaatatgtttacctaaagaaagtggtgggacaactcataaagagtagtgctatgacca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11022410 |
aaataccggaaaaactaggacaaggatgaatttttcttatctcaatatgtttacctaaagaaagtggtgggacaactcataaagagtagtgctatgacca |
11022311 |
T |
|
| Q |
101 |
ctgagattcctttggatcatcgcacaaaacttttgactatgcattatcctcaatttgaggatgagaagatggagggtacaccatatgcaagtgtggtagg |
200 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
11022310 |
ctgagattcctttggatcatcacacaaaacttttgactatgcattatcctcaatttgaggatgagaagatggagggtacaccatatgcaagtgtcgtagg |
11022211 |
T |
|
| Q |
201 |
aagcaccatgt |
211 |
Q |
| |
|
||||||||||| |
|
|
| T |
11022210 |
aagcaccatgt |
11022200 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University