View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16416_low_14 (Length: 325)
Name: NF16416_low_14
Description: NF16416
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16416_low_14 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 141; Significance: 6e-74; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 141; E-Value: 6e-74
Query Start/End: Original strand, 1 - 157
Target Start/End: Complemental strand, 746866 - 746710
Alignment:
| Q |
1 |
attttaatttttcatctatatgagtacatccatatgtcaaaggggacgtgcatgtgttaatacatataacattcaattttcagtaaaaacataacaagta |
100 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
746866 |
attttaatttttcatcaatatgagtacatgcatatgtcaaaggggacgtgcatgtgttaatacatataacattcaattttcagtaaaaacataacaagta |
746767 |
T |
|
| Q |
101 |
acaaagttaccaagctatttgttccacttaaaactaagaaaagaaattgttatacta |
157 |
Q |
| |
|
| |||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
746766 |
agaaagttaccaagctatttgttccatttaaaactaagaaaagaaattgttatacta |
746710 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 238 - 308
Target Start/End: Complemental strand, 746629 - 746559
Alignment:
| Q |
238 |
gctagtatggatgtctaaagcattacatgctacttcgttccattcttggagttgaacagttgagcttgaat |
308 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
746629 |
gctagtatggatgtctaaagcattacatgctacttcgttccattcttggagttgaacagttgagcttgaat |
746559 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University