View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16417_high_4 (Length: 312)
Name: NF16417_high_4
Description: NF16417
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16417_high_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 1 - 296
Target Start/End: Complemental strand, 13348667 - 13348372
Alignment:
| Q |
1 |
ttggatgcttcattggctgtcttgaacacacatgcttgcactgctactagcttgcttacttgggtcttccttgatgtcattttcttcagaaagccttctg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13348667 |
ttggatgcttcattggctgtcttgaacacacatgcttgcactgctactagcttgcttacttgggtcttccttgatgtcattttcttcagaaagccttctg |
13348568 |
T |
 |
| Q |
101 |
ttattggtgctgttcaaggcatgattactggtttggtttgcattacccctgctgcaggtttgtaatatttcattcattcttcaagatannnnnnncccct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
13348567 |
ttattggtgctgttcaaggcatgattactggtttggtttgcattacccctgctgcaggtttgtaatatttcattcattcttcaagatatttttttcccct |
13348468 |
T |
 |
| Q |
201 |
ttaaatccaatatatacgaggattattttgtacttgttttatattagttgatattttttcacttataactaagagcgcttggatgatatggttcat |
296 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||| | ||||||||| |
|
|
| T |
13348467 |
ttaaatccaatatttacgaggattattttgtacttgttttatattagttaatattttgtcacttataactaagagcgcttggataagatggttcat |
13348372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 70 - 146
Target Start/End: Complemental strand, 39725594 - 39725518
Alignment:
| Q |
70 |
cttgatgtcattttcttcagaaagccttctgttattggtgctgttcaaggcatgattactggtttggtttgcattac |
146 |
Q |
| |
|
||||||||||| ||||||| ||| || || |||||||| |||||||||||||||||||||||| | ||||||||||| |
|
|
| T |
39725594 |
cttgatgtcatattcttcaaaaaaccatcagttattggagctgttcaaggcatgattactggtcttgtttgcattac |
39725518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University