View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16417_low_10 (Length: 243)
Name: NF16417_low_10
Description: NF16417
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16417_low_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 12 - 224
Target Start/End: Original strand, 2794575 - 2794787
Alignment:
| Q |
12 |
gagatgaaggggtcgaatttggagtcaattttggaggagttatatgttgtgaaagcctctactatagagagggagaagaacttggagaagagtataaggt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2794575 |
gagatgaaggggtcgaatttggagtcaattttggaggagttatatgctgtgaaagcctctactatagagagggagaagaacttggagaagagtataaggt |
2794674 |
T |
 |
| Q |
112 |
acgaggctcgaaggttgaaagacggggacatggacattgataggggaactggtgatggagttggggaaaatgggggtcaatgccggatacttgatttgga |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||| |
|
|
| T |
2794675 |
acgaggctcgaaggttgaaagacggggacatggacattgataggggaactggtgatggagttggggaaaatgggggtcaacgccggatgcttgatttgga |
2794774 |
T |
 |
| Q |
212 |
taaccttgctttt |
224 |
Q |
| |
|
||||||||||||| |
|
|
| T |
2794775 |
taaccttgctttt |
2794787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University