View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16417_low_5 (Length: 306)
Name: NF16417_low_5
Description: NF16417
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16417_low_5 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 24 - 288
Target Start/End: Complemental strand, 1962175 - 1961911
Alignment:
| Q |
24 |
tcttctccaacctccaattgtccgatcccaatgtcttcatccccagaaggctacgcaatcgaactctacatggatccagctctcgaaaaccaagttctca |
123 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
1962175 |
tcttctccaacctccaattatccgatcccaatgtcttcatccccagaaggctacgcaatcgaactctacatggatccagcactcgaaaaccaagttctca |
1962076 |
T |
|
| Q |
124 |
aatcctggaacgtcctcgctcgccgtcaaatcagcacctccttaatcaccaccgcctcccgtcctcacatcactctcttctccaccacttcccttctcga |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
1962075 |
aatcctggaacgtcctcgctcgccgtcaaatcagcacctccttaatcaccaccgcctcccgtcctcacatcactctcttctccaccacttctcttctcga |
1961976 |
T |
|
| Q |
224 |
tcctctcaaactcgaacctctcctcaaaaccctaacaacaacaacttcccctttccctctctcct |
288 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
1961975 |
tcctctcaaactcgaacctctcctcaaaaccctaacaacaacaacctcccctttccctctctcct |
1961911 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University