View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16418_high_4 (Length: 296)
Name: NF16418_high_4
Description: NF16418
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16418_high_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 245; Significance: 1e-136; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 1 - 289
Target Start/End: Complemental strand, 12997990 - 12997703
Alignment:
| Q |
1 |
tcatcacttccaatggagcaatggcaacactttctggtgccaagacaggtcgttctcctagagacaagcgtgtggttaaggataaggttactgaaaatga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12997990 |
tcatcacttccaatggagcaatggcaacactttctggtgccaagacaggtcgttctcctagagacaagcgtgtggttaaggataaggttactgaaaatga |
12997891 |
T |
 |
| Q |
101 |
actttggtggggaaagtaagtacatactttggacaatatttgattcgatgcttctatctctatctttcaattttacttgttattaggaagcacgtatact |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||| ||| |||||| |
|
|
| T |
12997890 |
actttggtggggaaagtaagtacatactttggacaatatttgattcgatgcttctatctctgtctttcaattttatttgttattaggaaacacatatact |
12997791 |
T |
 |
| Q |
201 |
ttttggattatgcgtgtctctattagattatgtttggcgtccgacacatatgattgcatatattttttggattacgcgtgtctctgctg |
289 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||||||||||||||||||||| ||| |||||| ||||||||||| |||||||||||||| |
|
|
| T |
12997790 |
ttttggattatgcgtgtctctgttaga-tatgtttggcgtccgacacatatcattacatatactttttggattatgcgtgtctctgctg |
12997703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 1 - 289
Target Start/End: Complemental strand, 13072630 - 13072343
Alignment:
| Q |
1 |
tcatcacttccaatggagcaatggcaacactttctggtgccaagacaggtcgttctcctagagacaagcgtgtggttaaggataaggttactgaaaatga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13072630 |
tcatcacttccaatggagcaatggcaacactttctggtgccaagacaggtcgttctcctagagacaagcgtgtggttaaggataaggttactgaaaatga |
13072531 |
T |
 |
| Q |
101 |
actttggtggggaaagtaagtacatactttggacaatatttgattcgatgcttctatctctatctttcaattttacttgttattaggaagcacgtatact |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||| ||| |||||| |
|
|
| T |
13072530 |
actttggtggggaaagtaagtacatactttggacaatatttgattcgatgcttctatctctgtctttcaattttatttgttattaggaaacacatatact |
13072431 |
T |
 |
| Q |
201 |
ttttggattatgcgtgtctctattagattatgtttggcgtccgacacatatgattgcatatattttttggattacgcgtgtctctgctg |
289 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||||||||||||||||||||| ||| |||||| ||||||||||| |||||||||||||| |
|
|
| T |
13072430 |
ttttggattatgcgtgtctctgttaga-tatgtttggcgtccgacacatatcattacatatactttttggattatgcgtgtctctgctg |
13072343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 15 - 122
Target Start/End: Complemental strand, 28139138 - 28139031
Alignment:
| Q |
15 |
ggagcaatggcaacactttctggtgccaagacaggtcgttctcctagagacaagcgtgtggttaaggataaggttactgaaaatgaactttggtggggaa |
114 |
Q |
| |
|
|||||| |||| |||||||| || |||||||| || || | ||| ||||| |||||||| || |||||| | | ||||| ||||| ||||||||||||| |
|
|
| T |
28139138 |
ggagcattggctacactttcgggggccaagaccggacggtgtccaagagataagcgtgtcgtcaaggatgatctcactgagaatgagctttggtggggaa |
28139039 |
T |
 |
| Q |
115 |
agtaagta |
122 |
Q |
| |
|
|||||||| |
|
|
| T |
28139038 |
agtaagta |
28139031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University