View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16418_high_7 (Length: 240)
Name: NF16418_high_7
Description: NF16418
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16418_high_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 17 - 219
Target Start/End: Original strand, 39453158 - 39453360
Alignment:
| Q |
17 |
gcagagagcagcggattggggattggtgctgaaaactggttcggagacggaaaccatatggagtttcagtggtggttggttcgaggagggacttgatgaa |
116 |
Q |
| |
|
|||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
39453158 |
gcagagagcagcggattggggactggtgctcaaaactggttcggagacggaaaccatatggagtttcagtggtggttggttcgaggagggaattgatgaa |
39453257 |
T |
 |
| Q |
117 |
ttcctcttctctcattattcattcatgaagggggcctttaatgatataattaataaaggttcaaaatcacacccttattgagggtgatgactttccctgg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39453258 |
ttcctcttctctcattattcattcatgaagggggcctttaatgatataattaataaaggttcaaaatcacacccttattgagggtgatgactttccctgg |
39453357 |
T |
 |
| Q |
217 |
tat |
219 |
Q |
| |
|
||| |
|
|
| T |
39453358 |
tat |
39453360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University