View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16418_low_5 (Length: 254)
Name: NF16418_low_5
Description: NF16418
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16418_low_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 18 - 244
Target Start/End: Original strand, 8742991 - 8743214
Alignment:
| Q |
18 |
caaacatggctaagcactgctctcaccaaccttgagacatgtaaagctggattctacgatctcggtgttcaagattatattcttcctctcatgtccaaca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8742991 |
caaacatggctaagcactgctctcaccaaccttgagacatgtaaagctggattctacgatcttggtgttcaagattatattcttcctctcatgtccaaca |
8743090 |
T |
|
| Q |
118 |
atgttactaaattgctaagtaacactttggctcttaacaaagttcaacatcatcaagaacctagctacaaagatgggttcccaacatgggttaggccagg |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8743091 |
atgttactaaattgctaagtaacactttggctcttaacaaagttcaa---tatcaagaacctagctacaaagatgggttcccaacatgggttaggccagg |
8743187 |
T |
|
| Q |
218 |
tgatagaaagctattacaaacttcatc |
244 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
8743188 |
tgatagaaagctattacaaacttcatc |
8743214 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University