View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16418_low_7 (Length: 240)

Name: NF16418_low_7
Description: NF16418
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16418_low_7
NF16418_low_7
[»] chr7 (1 HSPs)
chr7 (17-219)||(39453158-39453360)


Alignment Details
Target: chr7 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 17 - 219
Target Start/End: Original strand, 39453158 - 39453360
Alignment:
17 gcagagagcagcggattggggattggtgctgaaaactggttcggagacggaaaccatatggagtttcagtggtggttggttcgaggagggacttgatgaa 116  Q
    |||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
39453158 gcagagagcagcggattggggactggtgctcaaaactggttcggagacggaaaccatatggagtttcagtggtggttggttcgaggagggaattgatgaa 39453257  T
117 ttcctcttctctcattattcattcatgaagggggcctttaatgatataattaataaaggttcaaaatcacacccttattgagggtgatgactttccctgg 216  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39453258 ttcctcttctctcattattcattcatgaagggggcctttaatgatataattaataaaggttcaaaatcacacccttattgagggtgatgactttccctgg 39453357  T
217 tat 219  Q
    |||    
39453358 tat 39453360  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University