View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16419_high_6 (Length: 241)
Name: NF16419_high_6
Description: NF16419
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16419_high_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 12 - 233
Target Start/End: Complemental strand, 52584639 - 52584418
Alignment:
| Q |
12 |
gctagctacaattaatgatgtcaaactccatgacccatcaaaatcaatttgagaaccaagaactactaggtggtggttatgtttcatcttctttgagaaa |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52584639 |
gctagctacaattaatgatgtcaaactccatgacccatcaaaatcaatttgagaaccaagaactactaggtggtggttatgtttcatcttctttgagaaa |
52584540 |
T |
|
| Q |
112 |
caacaatgcatatcatgaatcacttggaacattttctaacaatattgggctagcacaaggttctgagatgagtcacacaagacatttgatggatctactt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52584539 |
caacaatgcatatcatgaatcacttggaacattttctaacaatattgggctagcacaaggttctgagatgagtcacacaagacatttgatggatctactt |
52584440 |
T |
|
| Q |
212 |
ggtgcagcaaacgagaataatc |
233 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
52584439 |
ggtgcagcaaacgagaataatc |
52584418 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University