View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16419_low_8 (Length: 235)
Name: NF16419_low_8
Description: NF16419
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16419_low_8 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 15 - 235
Target Start/End: Complemental strand, 9541326 - 9541110
Alignment:
| Q |
15 |
atttccttctctatatcttcataattcatgttacttcctcttccgatctcaagtccgctacactgtttttccgagatattgtccataatgttctggctag |
114 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| |||||| |||||||||||||||| ||||||||||||||||||||||||| |||||||||| |
|
|
| T |
9541326 |
attttcttctctatatcttcataattcatgttacttcctattccgacctcaagtccgctacaccgtttttccgagatattgtccataattttctggctag |
9541227 |
T |
 |
| Q |
115 |
ggcatttcattaannnnnnncttccaactctagcctctgcataagaaggaattatagtatgtaaagcaatgataatagtactaagattaaaatatgacgt |
214 |
Q |
| |
|
|||||| |||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
9541226 |
ggcattccattaatttttttcttccaactctagcctc----aaagaaggaattatagtatgtaaagcaatgataatagtactaagattaaaatatgaagt |
9541131 |
T |
 |
| Q |
215 |
ccaaatgacataaatcatacc |
235 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
9541130 |
ccaaatgacataaatcatacc |
9541110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University