View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1641_low_12 (Length: 251)
Name: NF1641_low_12
Description: NF1641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1641_low_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 1 - 235
Target Start/End: Complemental strand, 2666562 - 2666342
Alignment:
| Q |
1 |
gttggtagcagttttctagtacttattttgctgaacacttaccaagacataagatttttatcccacaaaaagctgttatttatattaacaaaaaatattg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
2666562 |
gttggtagcagttttctagtacttattttgctgaatacttactaagacataagatttttatcccacaaaaagctgttatgtatattaacaaaaaatattg |
2666463 |
T |
 |
| Q |
101 |
tgtaacatgtatcatttacattcaagatgataaatcttcccctcaaaagatgataaatcttgagcaagaaaatggaagaattaggttgaatgaatgaaaa |
200 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
2666462 |
tgta--------------cattcaagatgataaatcttcccctcaaaagatgataaatcttgagcaaaaaaatggaagaattaggttgagtgaatgaaaa |
2666377 |
T |
 |
| Q |
201 |
atatacagatagaaattgtgaatgatatttattgt |
235 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |
|
|
| T |
2666376 |
atatagagatagaaattgtgaatgatatttattgt |
2666342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University