View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1642-INSERTION-4 (Length: 498)
Name: NF1642-INSERTION-4
Description: NF1642
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1642-INSERTION-4 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 237; Significance: 1e-131; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 238 - 498
Target Start/End: Complemental strand, 7266240 - 7265981
Alignment:
| Q |
238 |
tggtaggtatggcataccatccataaaccatccaccatcagatgaaatataagctcttctaacaatgagattcatatcagtaagaacttgaacaacttcc |
337 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7266240 |
tggtaggtatagcataccatccataaaccatccaccatcagatgaaatataagctcttctaacaatgagattcatatcagtaagaacttgaacaacttcc |
7266141 |
T |
|
| Q |
338 |
aacaaactaccacgtttattagcactatcaacctacacaaaattcacatgaaaattatttataaactaaactaaaatgacccttttgaaattcatcaaaa |
437 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||| |
|
|
| T |
7266140 |
aacaaactaccacgtttattagcactatcaacctacacaaaattcacatgaaaattatttataaactaaactaaaatgacccttttgaatttcatc-aaa |
7266042 |
T |
|
| Q |
438 |
gattaaaatcttaaaagttttaaatttcaaacctttatcaaagttgttgttctgcttgaag |
498 |
Q |
| |
|
||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7266041 |
gattaaaatcttataaggtttaaatttcaaacctttatcaaagttgttgttctgcttgaag |
7265981 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 83; E-Value: 4e-39
Query Start/End: Original strand, 8 - 90
Target Start/End: Complemental strand, 7266471 - 7266389
Alignment:
| Q |
8 |
cgatgaatattacacagatctattacctgttgaattctatcagcaacatcttcttgaagaatctttttcccattttgatcagt |
90 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7266471 |
cgatgaatattacacagatctattacctgttgaattctatcagcaacatcttcttgaagaatctttttcccattttgatcagt |
7266389 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University