View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1642-Insertion-12 (Length: 143)
Name: NF1642-Insertion-12
Description: NF1642
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1642-Insertion-12 |
| |
|
[»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 124; Significance: 4e-64; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 124; E-Value: 4e-64
Query Start/End: Original strand, 8 - 143
Target Start/End: Complemental strand, 328159 - 328025
Alignment:
Q |
8 |
tcaatatgatgaagacatgaaccacccgacatgaatggcatcacaacccatagattgtgatcactcacgaatgaacagtgtgattttagcacgttagggt |
107 |
Q |
|
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
T |
328159 |
tcaatatg-tgaagacatgaaccacccgacatgaatggcatcacaacccatagattgtgatcactcacgaatgagcagtgtgattttagcacgttagggt |
328061 |
T |
|
Q |
108 |
ggtccactagtaccattgtttgtgcttcacgagata |
143 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| |
|
|
T |
328060 |
ggtccactagtaccattgtttgtgcttcacgagata |
328025 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 25060 times since January 2019
Visitors: 1337