View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16421_high_4 (Length: 236)
Name: NF16421_high_4
Description: NF16421
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16421_high_4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 42224107 - 42223887
Alignment:
| Q |
1 |
atgatgtatgttgcacctttagctgtgatggtatgtaatcatcaaacaaacacttaatcttaattttttgtttggaagcgtttttattgaatttgaagta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
42224107 |
atgatgtatgttgcacctttagctgtgatggtatgtaatcatcaaacaaacacttaatcttaatttttggtttggatgcgtttttattgaatttgaagta |
42224008 |
T |
 |
| Q |
101 |
tttgataaaatttactattgctttgcagaaactggtgatcatgactaaaagcattgagtacatgccgctctccatatctcttgcttcctttggaaatggt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42224007 |
tttgataaaatttactattgctttgcagaaactggtgatcatgactaaaagcattgagtacatgccgctctccatatctcttgcttcctttggaaatggt |
42223908 |
T |
 |
| Q |
201 |
gtggcttggacaacttactct |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
42223907 |
gtggcttggacaacttactct |
42223887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 123 - 211
Target Start/End: Original strand, 36675871 - 36675959
Alignment:
| Q |
123 |
ttgcagaaactggtgatcatgactaaaagcattgagtacatgccgctctccatatctcttgcttcctttggaaatggtgtggcttggac |
211 |
Q |
| |
|
||||||||||| ||||||| ||||||||| |||||| ||||||| | | | ||||| | ||||| ||||| |||||||| ||||||| |
|
|
| T |
36675871 |
ttgcagaaactagtgatcaagactaaaagtgttgagttcatgccgtttttcctatctttagcttcatttggcaatggtgtttcttggac |
36675959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 123 - 211
Target Start/End: Original strand, 36685953 - 36686041
Alignment:
| Q |
123 |
ttgcagaaactggtgatcatgactaaaagcattgagtacatgccgctctccatatctcttgcttcctttggaaatggtgtggcttggac |
211 |
Q |
| |
|
||||||||||| ||||||| ||||||||| |||||| ||||||| | | | ||||| | ||||| ||||| |||||||| ||||||| |
|
|
| T |
36685953 |
ttgcagaaactagtgatcaagactaaaagtgttgagttcatgccgtttttcctatctttagcttcatttggcaatggtgtttcttggac |
36686041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University