View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16422_high_13 (Length: 270)
Name: NF16422_high_13
Description: NF16422
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16422_high_13 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 16 - 255
Target Start/End: Complemental strand, 14022796 - 14022569
Alignment:
| Q |
16 |
aatatgtatcaaaacaagatgctgctagaagatttgaataatggaaaatgcatgcacaaagactgttttgaaaacttnnnnnnnntatggtggttgcagg |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
14022796 |
aatatgtatcaaaacaagatgctgctagaagatttgaataatggaaaatgcatgcacaaagactgttttgaaaacttaaaaaaaatatggtggttgcagg |
14022697 |
T |
|
| Q |
116 |
ttggagaaccggatatgccattgaggtcttgttacttccatctatatggnnnnnnngtagttggtttagttcatgttcaattgatttgatcattgttgtg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||| || ||| |||||||||| ||||||| ||||||| |
|
|
| T |
14022696 |
ttggagaaccggatatgccattgaggtcttgttatttccatctatatggtttttttgtcgtttgtttagttca------------ttgatcactgttgtg |
14022609 |
T |
|
| Q |
216 |
tacaggtacattatctatattactttactactaaagttgt |
255 |
Q |
| |
|
|||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
14022608 |
tacaggtacattatctatattactgttctactaaagttgt |
14022569 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University