View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16422_low_15 (Length: 301)
Name: NF16422_low_15
Description: NF16422
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16422_low_15 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 158; Significance: 4e-84; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 16 - 213
Target Start/End: Complemental strand, 14023387 - 14023190
Alignment:
| Q |
16 |
atacaatgtcgaaatgtgatttctccgatcaaatttggatgaacaaagttgtttgactatgataacttcatgattctgatctagcaggaattcaagatcc |
115 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
14023387 |
atacaaggtcgaaatgtgatttctccgatcaaatttggacgaacaaagttgtttgactatgataacttcatgattctggtgtagcaggaattcaagatcc |
14023288 |
T |
 |
| Q |
116 |
ccctgttatacaaagatcaaatcacacacttgcaacaaagaattgcaatttgcaatattcaaaggtttgctgtctctctggactcgagagtctcataa |
213 |
Q |
| |
|
| |||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
14023287 |
ctctgtcatacaaagatcaaatcacatacttgcaacaaagaattgcaatttgcaatattctaaggtttgctgtctgtctggactctagagtctcataa |
14023190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 227 - 301
Target Start/End: Complemental strand, 14022858 - 14022784
Alignment:
| Q |
227 |
cttgtcatattctcaagtcaagactacacttattaacatcaaaagcttgtcaaataaccaaaaatatgtatcaaa |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
14022858 |
cttgtcatattctcaagtcaagactacacttattaacatcaacagcttgtcaaataaccaaaaatatgtatcaaa |
14022784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 102 - 154
Target Start/End: Complemental strand, 10462977 - 10462925
Alignment:
| Q |
102 |
ggaattcaagatccccctgttatacaaagatcaaatcacacacttgcaacaaa |
154 |
Q |
| |
|
||||||||| ||||| || |||||||||||| ||| |||||||||||||||| |
|
|
| T |
10462977 |
ggaattcaaaatccctctactatacaaagatccaataacacacttgcaacaaa |
10462925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University