View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16422_low_19 (Length: 247)
Name: NF16422_low_19
Description: NF16422
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16422_low_19 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 194; Significance: 1e-105; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 202
Target Start/End: Complemental strand, 13447816 - 13447615
Alignment:
| Q |
1 |
ttgattcaatttttggtgtgtacgtggctattctaacttcttaatgtgtttttgcatttattttaatttttcaactgcgagagtgtttatgtcaacactt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13447816 |
ttgattcaatttttggtgtgtacgtggctattctaacttcttaatgtgtttttgcatttattttaatttttcaactgcgagagtgtttatgtcaacactt |
13447717 |
T |
|
| Q |
101 |
ctgtcagtctgacattgctgttgtttacagtcgaatgaaatggaagaatcctgtaaagctggtttctgtactttaaatctctagattttgtgggatcctg |
200 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
13447716 |
ctgtcagtctgacattgccgttgtttacagtcgaatgaaatggaagaatcctgtaaagctggttcctgtactttaaatctctagattttgtgggatcctg |
13447617 |
T |
|
| Q |
201 |
tc |
202 |
Q |
| |
|
|| |
|
|
| T |
13447616 |
tc |
13447615 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 11 - 74
Target Start/End: Complemental strand, 13454249 - 13454185
Alignment:
| Q |
11 |
ttttggtgtgtacgtggctattctaacttcttaatgtgtttttgcatttatttt-aatttttcaa |
74 |
Q |
| |
|
||||| ||||||||||| | |||||||||||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
13454249 |
ttttgttgtgtacgtggttcttctaacttcttaatgtgttttcgcatttattttcaatttttcaa |
13454185 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University