View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16422_low_20 (Length: 238)
Name: NF16422_low_20
Description: NF16422
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16422_low_20 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 89; Significance: 5e-43; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 73 - 221
Target Start/End: Complemental strand, 31083238 - 31083093
Alignment:
| Q |
73 |
aaaagaattaatgtttgtttaagttttctgaatnnnnnnngttatgcaaattttnnnnnnnttaataaacttgttgatggacgacatattactagtttac |
172 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||| |||||| ||||||||||||||| |
|
|
| T |
31083238 |
aaaagaattaatgtttgtttaagttttctgaataaaaaaagttatgcaaatttttaaaaaattaataaacttgttaatggac---atattactagtttac |
31083142 |
T |
 |
| Q |
173 |
aaaattaatcatatttattattttttaagcaaaagtgaatcatatttct |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31083141 |
aaaattaatcatatttattattttttaagcaaaagtgaatcatatttct |
31083093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 17 - 88
Target Start/End: Complemental strand, 31083324 - 31083253
Alignment:
| Q |
17 |
aatatccttgacatagattagttaattaatcaaacatttgctacatataacatgataaaagaattaatgttt |
88 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31083324 |
aatatccttgacatagattagttaattaatcaaacatttgctacatataacatgataaaagaattaatgttt |
31083253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University