View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16422_low_21 (Length: 236)
Name: NF16422_low_21
Description: NF16422
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16422_low_21 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 19 - 233
Target Start/End: Complemental strand, 52476853 - 52476639
Alignment:
| Q |
19 |
atagcttgctatgtgcagctgagcatcatcacaaactcattcgtagccgtctcttgagtttgttctcgcctcattctttgccttcctttgttcaactgtt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52476853 |
atagcttgctatgtgcagctgagcatcatcacaaactcattcgtagccgtctcttgagtttgttctcgcctcattctttgccttcctttgttcaactgtt |
52476754 |
T |
|
| Q |
119 |
tgatgaacttgtaactgaagctacaagtacctggacatgtggatcccttgtcatcatacaagatgaagcactcaaggtacatgttatattcccttcgtcc |
218 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52476753 |
tgatgaacttgtaactgaagctacaggtacctggacatgtggatcccttgtcatcatacaagatgaagcactcaaggtacatgttatattcccttcgtcc |
52476654 |
T |
|
| Q |
219 |
acaataactatatat |
233 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
52476653 |
acaataactatatat |
52476639 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University