View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16423_low_12 (Length: 252)
Name: NF16423_low_12
Description: NF16423
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16423_low_12 |
 |  |
|
| [»] scaffold0693 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0693 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: scaffold0693
Description:
Target: scaffold0693; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 19 - 242
Target Start/End: Complemental strand, 3254 - 3020
Alignment:
| Q |
19 |
gtagaacaagctgagaaagagtgtttgcataattgaagcatgttatacccagcagctgcagatgtcacatacaacaagatcctnnnnnnncatacaaaaa |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
3254 |
gtagaacaagctgagaaagagtgtttgcataattgaagcatgttatacccagcagctgcagatgtcacatacaacaagatcctaaaaaaacatacaaaaa |
3155 |
T |
 |
| Q |
119 |
t-----------gatcatggtatatacttcaacataaaatgtgagaacagacaaataaagaagaagaattttacttgagagcatccaagtccttgtaagt |
207 |
Q |
| |
|
| |||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3154 |
ttcctaattcaagatcatggtacatatttcaacataaaatgtgagaacagacaaataaagaagaagaattttacttgagagcatccaagtccttgtaagt |
3055 |
T |
 |
| Q |
208 |
agcttttttcttaatcattaatattacaacctttg |
242 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| |
|
|
| T |
3054 |
agctttcttcttaatcattaatattacaacctttg |
3020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University