View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16423_low_4 (Length: 417)
Name: NF16423_low_4
Description: NF16423
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16423_low_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 172; Significance: 3e-92; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 172; E-Value: 3e-92
Query Start/End: Original strand, 1 - 176
Target Start/End: Complemental strand, 28114190 - 28114015
Alignment:
| Q |
1 |
aactagtcttccagagtggtatgggattcgttcttcaaaaatgctaggacaagcttggtgccctagaggtggatttggcttggttagtagtactcatcac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28114190 |
aactagtcttccagagtggtatgggattcgttcttcaaaaatgctaggacaagcttggtgccctagaggtggatttggcttggttagtagtactcatcac |
28114091 |
T |
|
| Q |
101 |
tatcactctctcttactatgtttctaaatattgttgttatttttagttatattgaatgagcaatagatggattgtt |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
28114090 |
tatcactctctcttactatgtttctaaatattgttgttatttttagttatattgaatgaggaatagatggattgtt |
28114015 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 119; E-Value: 1e-60
Query Start/End: Original strand, 233 - 400
Target Start/End: Complemental strand, 28113452 - 28113288
Alignment:
| Q |
233 |
agattgcacgaataaattccaaagctaaaccaccaaa-atccatccatttgtgatataatcacttgttaatttatataactaactattgaccaaatgtaa |
331 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
28113452 |
agattgcacgaataaattccaaagctaaaccaccaagcatccatccatttgtgatataatcacttgttaatttatataacta----ttgaccaaatgtaa |
28113357 |
T |
|
| Q |
332 |
ctttccaaacatatatattttggaaatttttaacatgnnnnnnngcttataatagtgaaggaagggagt |
400 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
28113356 |
ctttccaaacatatatattttggaaatttttaacatgcttttttgcttataatagtgaaggaagggagt |
28113288 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University