View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16424_high_12 (Length: 250)
Name: NF16424_high_12
Description: NF16424
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16424_high_12 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 22 - 231
Target Start/End: Original strand, 48166607 - 48166816
Alignment:
| Q |
22 |
aggtgaaaatagactaggttaaactttgctaggctgaacatgacttgctttgaaaatgttaggcttcaatctgtcctattagtctgccataggctcattt |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48166607 |
aggtgaaaatagactaggttaaactttgctaggctgaacatgacttactttgaaaatgttaggcttcaatctgtcctattagtctgccataggctcattt |
48166706 |
T |
|
| Q |
122 |
ttaaggtttgacctgactttttggtaagtccgtttaatagtctatttcacgannnnnnnngacgaaaaatatacaccactaataatggtgtagactgtca |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
48166707 |
ttaaggtttgacctgactttttggtaagtccgtttaatagtctatttcacgattttttttgacgaaaaatatacaccactaataatggtgtagattgtca |
48166806 |
T |
|
| Q |
222 |
taaataaact |
231 |
Q |
| |
|
|||||||||| |
|
|
| T |
48166807 |
taaataaact |
48166816 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University