View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16424_low_12 (Length: 294)
Name: NF16424_low_12
Description: NF16424
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16424_low_12 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 35 - 277
Target Start/End: Complemental strand, 3856227 - 3855983
Alignment:
| Q |
35 |
gcatatgttattgttgcgtgatgaatgaagattattgttttaaactgttgtttcgtcatgactctctaccagcggatcttcttcttcccctccaaagtga |
134 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
3856227 |
gcatatgttattgttgcgtgaagaatgaagattattgttttaaactgttgtttcgtcatgactctcctccagcggatcttcttcttcccctccaaagtga |
3856128 |
T |
|
| Q |
135 |
tgcggctggaactttctttatgagagaatagctttatgtttcttctttttcctgttttcttgtttgtaac--nnnnnnnnngccgtggtttcttattttg |
232 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||| |
|
|
| T |
3856127 |
tgcggctggaactttctttctgagagaatagctttatgtttcttctttttcctgttttcttgtttgtaacaaaaaaaaaaagctgtggtttcttattttg |
3856028 |
T |
|
| Q |
233 |
ttgaacaagtctctcctagtactggtccaactataaggaagtaca |
277 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3856027 |
ttgaacaagtctctcctagtactggtccaactataaggaagtaca |
3855983 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 123 - 167
Target Start/End: Complemental strand, 50822750 - 50822706
Alignment:
| Q |
123 |
cctccaaagtgatgcggctggaactttctttatgagagaatagct |
167 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||||||| ||||| |
|
|
| T |
50822750 |
cctccaaagtgatgcggctgaaattttctttttgagagagtagct |
50822706 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University