View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16425_high_14 (Length: 232)
Name: NF16425_high_14
Description: NF16425
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16425_high_14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 15 - 211
Target Start/End: Original strand, 40011666 - 40011862
Alignment:
| Q |
15 |
gagcacagaggagacaaacttaagagggagagtttgattgagttgaaggaaatgtttcgtgagagaaaaatggatgaattgaaatgggtttttgaggatg |
114 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40011666 |
gagcacagaggagagaaacttaagagggagagtttgattgagttgaaggaaatgtttcgtgagagaaaaatggatgaattgaaatgggtttttgaggatg |
40011765 |
T |
|
| Q |
115 |
atattgaaattaacgaggtttggttcgatgaaaataacaatgggaaaaggaaaaagacgagtaagcgaagtgaggttcaggttgtgaggtttcttgt |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40011766 |
atattgaaattaacgaggtttggttcgatgaaaataacaatgggaaaaggaaaaagacgagtaagcgaagtgaggttcaggttgtgaggtttcttgt |
40011862 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University