View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16425_low_8 (Length: 384)
Name: NF16425_low_8
Description: NF16425
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16425_low_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 171; Significance: 1e-91; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 171; E-Value: 1e-91
Query Start/End: Original strand, 109 - 374
Target Start/End: Original strand, 1331175 - 1331434
Alignment:
| Q |
109 |
tcgttggttaatccctcggaaggttgtggaaaatgtagatcgtggtnnnnnnn--cccgcatatgtttcaaagaaaacaattcataaatatgttgacaag |
206 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||||||||| |||| || ||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
1331175 |
tcgttggttgatccctcggaagattgtggaaaatgtagatcatggtaaaaaaaaacctgcatatgtttcgaagaaaacaattcataaatatgttgacaag |
1331274 |
T |
 |
| Q |
207 |
gagaatacatacggcatagcatcctccaaggcttttgaagcgcgggtgcaacacttgttattactcatgttgaaaattttgttgatgatgacgacattgt |
306 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
1331275 |
gagaatgcatacggcatagcatcctccaaggcttttgaagtgc--------cacttgttattactcatgttgaaaattttgttgataatgacgacattgt |
1331366 |
T |
 |
| Q |
307 |
tgatgcaaatgacgcgactcatgatggtactaatgacgttaatgttgatgcaattggtgtgacctatg |
374 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
1331367 |
tgatgcaaatgacgcgactcatgatggtactgatgacgttaatgttgatgcaattggtgtgacctatg |
1331434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University