View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16427_high_16 (Length: 260)
Name: NF16427_high_16
Description: NF16427
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16427_high_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 112; Significance: 1e-56; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 16 - 127
Target Start/End: Complemental strand, 16951280 - 16951169
Alignment:
| Q |
16 |
gcaacaacattgaataatcgagacacatctccttcgcaagagctataagccttcgatgaatgccataaagttcagcttaaaggatgtcagttgaacgctc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16951280 |
gcaacaacattgaataatcgagacacatctccttcgcaagagctataagccttcgatgaatgccataaagttcagcttaaaggatgtcagttgaacgctc |
16951181 |
T |
 |
| Q |
116 |
ataatataatga |
127 |
Q |
| |
|
|||||||||||| |
|
|
| T |
16951180 |
ataatataatga |
16951169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University