View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16427_high_19 (Length: 237)
Name: NF16427_high_19
Description: NF16427
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16427_high_19 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 17824264 - 17824484
Alignment:
| Q |
1 |
catgaaccaactccgaggacaccgaattggacggcatgaagttacggtctgggtaactcgaagacaccagaaaacatcaggctggacgacacgaagctat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17824264 |
catgaaccaactccgaggacaccgaattggacgacatgaagttacggtctgggtaactcgaagacaccagaaaacatcaggctggacgacacgaagctac |
17824363 |
T |
|
| Q |
101 |
ggacccggtgacttaaggggtcctggaaatcccaaattggacgacactaagctacggcaacggaaactccatggacctcacaacaaatattactcctcaa |
200 |
Q |
| |
|
| |||||||||||||||||||||| |||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17824364 |
gaacccggtgacttaaggggtcctagaaatcccaaatcggacgacactaggctacggcaacggaaactccatggacctcacaacaaatattactcctcaa |
17824463 |
T |
|
| Q |
201 |
accctgaaagccatggcatgg |
221 |
Q |
| |
|
| ||||||| ||||||||||| |
|
|
| T |
17824464 |
agcctgaaatccatggcatgg |
17824484 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University