View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16427_high_22 (Length: 215)
Name: NF16427_high_22
Description: NF16427
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16427_high_22 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 172; Significance: 1e-92; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 1 - 199
Target Start/End: Original strand, 24232575 - 24232771
Alignment:
| Q |
1 |
atctttgattattgttataatgttctcttgaatgaatgtggtttcaatgttagggaggaacgttatttatacttaagggtgaagcttcaacaccattaac |
100 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24232575 |
atctttgattatttttataatgttctcttgaatgaatgtggtttcaatgttagggaggaacgttatttatacttaagggtgaagcttcaacaccattaac |
24232674 |
T |
|
| Q |
101 |
attctatggtaagcaaacaattgtctaaatatgtctctttccttttttaattgcttggtttttgttttgtgtctattattagcaatcattcttcatctc |
199 |
Q |
| |
|
||| ||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
24232675 |
attatat--tgagcaaacaattgtctaaatatgtctctttccttttttaattgcttggtttttgttttgtgtctattaatagcaatcattcttcatctc |
24232771 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 1 - 160
Target Start/End: Original strand, 24244292 - 24244450
Alignment:
| Q |
1 |
atctttgattattgttataatgttctcttgaatgaatgtggtttcaatgttagggaggaacgttatttatacttaagggtgaagcttcaacaccattaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24244292 |
atctttgattattgttataatgttctcttgaatgaatgtggtttcaatgttagggaggaacgttatttatacttaagggtgaagcttcaacaccattaac |
24244391 |
T |
|
| Q |
101 |
attctatggtaagcaaacaattgtctaaatatgtctctttccttttttaattgcttggtt |
160 |
Q |
| |
|
| | |||||| ||||||| |||||||||||||||||||||| ||||||||| | |||||| |
|
|
| T |
24244392 |
a-tatatggtgagcaaactattgtctaaatatgtctctttctttttttaatcgtttggtt |
24244450 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 1 - 160
Target Start/End: Complemental strand, 24297906 - 24297748
Alignment:
| Q |
1 |
atctttgattattgttataatgttctcttgaatgaatgtggtttcaatgttagggaggaacgttatttatacttaagggtgaagcttcaacaccattaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24297906 |
atctttgattattgttataatgttctcttgaatgaatgtggtttcaatgttagggaggaacgttatttatacttaagggtgaagcttcaacaccattaac |
24297807 |
T |
|
| Q |
101 |
attctatggtaagcaaacaattgtctaaatatgtctctttccttttttaattgcttggtt |
160 |
Q |
| |
|
| | |||||| ||||||| |||||||||||||||||||||| ||||||||| | |||||| |
|
|
| T |
24297806 |
a-tatatggtgagcaaactattgtctaaatatgtctctttctttttttaatcgtttggtt |
24297748 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University