View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16427_low_11 (Length: 393)
Name: NF16427_low_11
Description: NF16427
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16427_low_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 289; Significance: 1e-162; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 6 - 310
Target Start/End: Original strand, 6041126 - 6041430
Alignment:
| Q |
6 |
tgagatgaagaagaagaagatagtttcatgtttgctaaacgtttatctgatttaacatgttcaacttggataccaagcttgcttgaaacctttctttgaa |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6041126 |
tgagatgaagaagaagaagatagtttcatgtttgctaaacgtttatctgatttaacatgttcaacttggataccaagcttgcttgaaacctttctttgaa |
6041225 |
T |
 |
| Q |
106 |
ccatttttcaagaaaggaagaagaaaaaattacaagagggaaataggaatttgcataaattggtttttccttccttggttttgtggagttcaagtagagg |
205 |
Q |
| |
|
|||||||||||||||||||||| || ||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
6041226 |
ccatttttcaagaaaggaagaaaaagaaattacaagagggaaataagaatttgcataaattggtttttccttccttggtcttgtggagttcaagtagagg |
6041325 |
T |
 |
| Q |
206 |
aaggaaagaaaaaccttgttgatgtagttttggttttcatatgaggaaagttcatcacaaaggaaagaaaagtttgaaagcttgaaacacaaacaagtag |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6041326 |
aaggaaagaaaaaccttgttgatgtagttttggttttcatatgaggaaagttcatcacaaaggaaagaaaagtttgaaagcttgaaacacaaacaagtag |
6041425 |
T |
 |
| Q |
306 |
agaga |
310 |
Q |
| |
|
||||| |
|
|
| T |
6041426 |
agaga |
6041430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University