View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16427_low_28 (Length: 206)
Name: NF16427_low_28
Description: NF16427
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16427_low_28 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 151; Significance: 4e-80; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 6 - 188
Target Start/End: Complemental strand, 5159802 - 5159619
Alignment:
| Q |
6 |
agatggacat-catcataactatgaccactttgtgcttnnnnnnncaattagtatttttattaaaaggagacagtgatgacgatctatcttatgcaactt |
104 |
Q |
| |
|
|||||||||| ||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5159802 |
agatggacatacattataactatgaccactttgtgcttaaaaaaacaattagtatttttattaaaaggagacagtgatgacgatctatcttatgcaactt |
5159703 |
T |
|
| Q |
105 |
ggtatttagaagctttggtatcatataaacatccaactaggcaataaaagggtatacttggattggtgttattgacagactgct |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5159702 |
ggtatttagaagctttggtatcatataaacatccaactaggcaataaaagggtatacttggattggtgttattgacagactgct |
5159619 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University