View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16428_high_2 (Length: 396)
Name: NF16428_high_2
Description: NF16428
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16428_high_2 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 107; Significance: 2e-53; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 107; E-Value: 2e-53
Query Start/End: Original strand, 7 - 137
Target Start/End: Complemental strand, 20129289 - 20129159
Alignment:
| Q |
7 |
tcgaagaaaatcatgaatttgtccatgaatctgctccacctgaggagtcatccgcaagctagtagccattgtcgccggtgacaacagaatcgatcacccg |
106 |
Q |
| |
|
||||| || ||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20129289 |
tcgaaaaatatcatgaatttgtccatgaatctgctccacctgaggagtcatctgcaagctggtagccattgtcgccggtgacaacagaatcgatcacccg |
20129190 |
T |
 |
| Q |
107 |
gcggaaaccctaggttgttgatttggggaag |
137 |
Q |
| |
|
|||||||||||||||||||| ||||| |||| |
|
|
| T |
20129189 |
gcggaaaccctaggttgttgttttggtgaag |
20129159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University