View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16429_low_3 (Length: 206)
Name: NF16429_low_3
Description: NF16429
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16429_low_3 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 66; Significance: 2e-29; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 79 - 171
Target Start/End: Complemental strand, 5467760 - 5467667
Alignment:
| Q |
79 |
agccaaatttaacaacatccatggaaaattcgacaaatgatttcaatg-ggggaatggtagatctaccagaggaaacacacaaaagctaagcaa |
171 |
Q |
| |
|
|||| |||||||||||||| | |||||||||||||||||||||||||| |||||||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
5467760 |
agcctaatttaacaacatcgacggaaaattcgacaaatgatttcaatggggggaatggtagatctactaggggaaacacacaaaagctaagcaa |
5467667 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 8 - 79
Target Start/End: Complemental strand, 5468044 - 5467973
Alignment:
| Q |
8 |
gagtataatgttgaatgggcgaaattggtgtatctggaaggttcaggatataccgcatgggaccgaattgaa |
79 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||| ||||||| |
|
|
| T |
5468044 |
gagtataatgttgaatgggcgaaattggtgtatcttgacggttcaggatataccgcatgggaccaaattgaa |
5467973 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University