View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1642_low_1 (Length: 317)
Name: NF1642_low_1
Description: NF1642
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1642_low_1 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 16 - 305
Target Start/End: Original strand, 53307105 - 53307394
Alignment:
| Q |
16 |
cacgttccacttcatatactacttgaattcattgcttgtaannnnnnnnnnnnnnnagtgatcgagcaaattaaacgcattactttgggtctctaaatgt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53307105 |
cacgttccacttcatatactacttgaattcattgcttgtaattttattagatttttagtgatcgagcaaattaaacgcattactttgggtctctaaatgt |
53307204 |
T |
 |
| Q |
116 |
tgcaaacctttcggcgactgcagcgcggtcgtctccgttgctcatgcacactgcaattttcaagattgttttaagctttctttagtctaatctcgtgtgc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53307205 |
tgcaaacctttcggcgactgcagcgcggtcgtctccgttgctcatgcacactgcaattttcaagattgttttaagctttctttagtctaatctcgtgtgc |
53307304 |
T |
 |
| Q |
216 |
aaagcttataagcttgctttttcttgacgcattcaattaaaattgtatggccatcccaatgaaaattgtagtattattgtaattcatctc |
305 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53307305 |
aaagcttataggcttgctttttcttgacgcattcaattaaaattgtgtggccatcccaatgaaaattgtagtattattgtaattcatctc |
53307394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University