View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1642_low_4 (Length: 282)
Name: NF1642_low_4
Description: NF1642
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1642_low_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 17 - 269
Target Start/End: Complemental strand, 23861688 - 23861435
Alignment:
| Q |
17 |
atgaattacttgcctttttagtgtctaaaggttctttaatcaattggggattattatgtaagttgttgtccttcacaagcttttgttgccaagctttttt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23861688 |
atgaattacttgcctttttagtgtctaaaggttctttaatcaattggggattattatgtaagttgttgtccttcacaagcttttgttgccaagctttttt |
23861589 |
T |
|
| Q |
117 |
cacacgctcgttcttacctatatcaacatgttttggttg-nnnnnnnnnngttcttcccctcatcaaccagagttggttcaataatattatcgtaaatct |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23861588 |
cacacgctcgttcttacctatatcaacatgttttggttgtttttttttttgttcttcccctcatcaaccagagttggttcaataatattatcgtaaatct |
23861489 |
T |
|
| Q |
216 |
tgatgcactggtgtattgaatgacttttgattttatatctttcacagaaagatg |
269 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23861488 |
tgatgcactagtgtattgaatgacttttgattttatatctttcacagaaagatg |
23861435 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 9783 times since January 2019
Visitors: 6078