View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1642_low_9 (Length: 240)
Name: NF1642_low_9
Description: NF1642
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1642_low_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 9 - 217
Target Start/End: Original strand, 28524549 - 28524761
Alignment:
| Q |
9 |
gagatgaattggcgggagtatgagagagtgagagtactccaatgaagaaacc----gtatatatcagtgacagtgacacagtagttgagagttgaacggc |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28524549 |
gagatgaattggcgggagtatgagagagtgagagtactccaatgaagaaacttatagtatatatcagtgacagtgacacagtagttgagagttgaacggc |
28524648 |
T |
|
| Q |
105 |
ttcgatttcgaactttttgtcttctcttcctccttcattcacattcaccaccaccatggatactacactctccgttctcaaggtaaaccctattatatca |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
28524649 |
ttcgatttcgaactttttgtcttctcttcctccttcattcacattcaccaccaccatggataccacactctccgttctcaaggtaaaccctattatatca |
28524748 |
T |
|
| Q |
205 |
ttcaaccccattc |
217 |
Q |
| |
|
||||||||||||| |
|
|
| T |
28524749 |
ttcaaccccattc |
28524761 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University