View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1643-INSERTION-4 (Length: 173)
Name: NF1643-INSERTION-4
Description: NF1643
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1643-INSERTION-4 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 155; Significance: 1e-82; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 155; E-Value: 1e-82
Query Start/End: Original strand, 7 - 173
Target Start/End: Complemental strand, 45879175 - 45879009
Alignment:
| Q |
7 |
agatttgccaaaatctaatgtaatacaatcattatgtacaaaaaatgaagatgagataattgggttgcaattgctttctcaatcaggttcattagttttg |
106 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
45879175 |
agatttgctaaaatctaatgtaatacaatcattatgtacaaaaaatgaagatgagataattgggttacaattgctttctcaatcaggttcattagttttg |
45879076 |
T |
|
| Q |
107 |
tgtcacacttgcactttgtgataattacactctatattattgttttcatggccgtagttctatataa |
173 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45879075 |
tgccacacttgcactttgtgataattacactctatattattgttttcatggccgtagttctatataa |
45879009 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University