View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1643-INSERTION-5 (Length: 216)
Name: NF1643-INSERTION-5
Description: NF1643
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1643-INSERTION-5 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 8 - 216
Target Start/End: Original strand, 657540 - 657749
Alignment:
| Q |
8 |
tgttccagaagagctctctgtcgcagaaatagttaaggcaccatctgaacttatatcgaagcgaagagtgatagtgggaacaccacatttagcaggagga |
107 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
657540 |
tgttccagaagagctctctgttgcagaaatagttaaggcaccatctgaacttatatcgaagccaagagtgatagtgggaacaccacatttagcaggagga |
657639 |
T |
|
| Q |
108 |
atgccaa-gagttctaattctcctagtttagtgtttctgttaacactttgttcatctccttcatagatcgaaaaacacatttcattttgattatcttgaa |
206 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||| |
|
|
| T |
657640 |
atgccaaggagttctaattctcctagtttagtgtttctgttaacactttgttcatctccttcatagatcaacaaacacatttcattttgattatcttgaa |
657739 |
T |
|
| Q |
207 |
ccgttgtgat |
216 |
Q |
| |
|
|||||||||| |
|
|
| T |
657740 |
ccgttgtgat |
657749 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University