View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16430_low_2 (Length: 515)
Name: NF16430_low_2
Description: NF16430
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16430_low_2 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 284; Significance: 1e-159; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 1 - 292
Target Start/End: Complemental strand, 31905126 - 31904835
Alignment:
| Q |
1 |
tatgagactcaaaaagaagagaagattcagtgtagatgagatgaaaagctgtagtgggtctccaaccagcaatccaatgaagagaacgttcaagtgttgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31905126 |
tatgagactcaaaaagaagagaagattcagtgtagatgagatgaaaagctgtagtgggtctccaaccagcaatccaatgaagagaacgttcaagtgttgt |
31905027 |
T |
|
| Q |
101 |
agcccaaggagatgctaaaacatgcagtggatctttttcagcagccattgattttgcattgtagtaatcttgatggtgagagagaactttttggatgagt |
200 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31905026 |
agcccaaggagatgctaagacatgcagtggatctttttcagcagccattgattttgcattgtagtaatcttgatggtgagagagaactttttggatgagt |
31904927 |
T |
|
| Q |
201 |
tcttctgattcggtttgggttgaggttgatagtttgagttggtggattaggttgttgaattgagtgtgccatgattcgtagaattgagcaaa |
292 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31904926 |
tcttctgagtcggtttgggttgaggttgatagtttgagttggtggattaggttgttgaattgagtgtgccatgattcgtagaattgagcaaa |
31904835 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 434 - 496
Target Start/End: Complemental strand, 31904716 - 31904654
Alignment:
| Q |
434 |
agtggggtacagaagaggagaggttttggggtgatgacacgttcacatcttacgtgtaatact |
496 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
31904716 |
agtggggtacagaagaggagaggttttggggtgatgacacgttgacatcttacgtgtaatact |
31904654 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University