View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16431_low_4 (Length: 617)
Name: NF16431_low_4
Description: NF16431
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16431_low_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 70; Significance: 3e-31; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 70; E-Value: 3e-31
Query Start/End: Original strand, 468 - 598
Target Start/End: Original strand, 38557801 - 38557938
Alignment:
| Q |
468 |
aataaagcatatatagactgaataattgaaatcaggttgttcgtagctaaattgaccctatttatg-------nnnnnnnnnnataacttggatgtaatg |
560 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||| ||||||||||||||||| |
|
|
| T |
38557801 |
aataaagcatatatagactgaataattgaaatcaggttgttcgtagctaaattgacactaattatgtttttttttttttttttataacttggatgtaatg |
38557900 |
T |
 |
| Q |
561 |
atttgtttaattttgatcttccacgaccatgaagccac |
598 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
38557901 |
atttgtttaattttgatcttccatgaccatgaagccac |
38557938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University