View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16432_low_13 (Length: 369)
Name: NF16432_low_13
Description: NF16432
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16432_low_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 327; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 327; E-Value: 0
Query Start/End: Original strand, 19 - 353
Target Start/End: Original strand, 35034654 - 35034988
Alignment:
| Q |
19 |
gaccaacatactcgagaaatactaatgcagctggagtgcgtagaaatgtcagcatgccgccaccaccatcaccaccatctgcattgcctatggttcaccc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35034654 |
gaccaacatactcgagaaatactaatgcagctggagtgcgtagaaatgccagcatgccgccaccaccatcaccaccatctgcattgcctatggttcaccc |
35034753 |
T |
 |
| Q |
119 |
tctccctccttttcaccaatatggctatataccttatggtatgaattacggttggcctaataccatgatgtggcctttattaaacatgtcgggcaatacc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35034754 |
tctccctccttttcaccaatatggctatataccttatggtatgaattacggttggcctaataccatgatgtggcctttattaaacatgtcgggcaatacc |
35034853 |
T |
 |
| Q |
219 |
atgatgcaacctttcttgaacatgacgggtaacaccatgatgcaaccttacagacccataagcgaacaaaattttctagaacgtcgtgtttcaactccaa |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35034854 |
atgatgcaacctttcttgaacatgacgggtaacaccatgatgcaaccttacagacccataagtgaacaaaattttctagaacgtcgtgtttcaactccaa |
35034953 |
T |
 |
| Q |
319 |
ctcctattggtacaaatcaagttggacctaatatc |
353 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
35034954 |
ctcctattggtacaaatcaagttggacctaatatc |
35034988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University