View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16432_low_16 (Length: 309)
Name: NF16432_low_16
Description: NF16432
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16432_low_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 14 - 292
Target Start/End: Complemental strand, 26801662 - 26801362
Alignment:
| Q |
14 |
tacttggagttcattgttgtgtatattattagataggtctgaaagtttttt-ctctctttctgatttgtgagatgttgtgagaatttttaatgataagtt |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26801662 |
tacttggagttcattgttgtgtatattattagataggtctgaaagtttttttctctctttctgatttgtgagatgttgtgagaatttttaatgataagtt |
26801563 |
T |
 |
| Q |
113 |
tgagtgtgctaaagcattttattttgcatagttcaagaacaagaaaaatattactaatggtgttatgaagggaaatagatttggtgtattaaccgggtca |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||| |||||| |
|
|
| T |
26801562 |
tgagtgtgctaaagcattttattttgcatagttcaagaacaagaaaaatattactaatggtgttattaagggaaatagatttggtgcattaactgggtca |
26801463 |
T |
 |
| Q |
213 |
aaca---------------------tgtccgagatcatttaaagttgattttattacgtgcaatttgagtcgtcttatctccgactcaagatcaagatca |
291 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
26801462 |
aacatgttctagtctcagtctcaactgtctgagatcatttaaagttgattttattacgtgcaatttgaaccgtcttatctccgactctagatcaagatca |
26801363 |
T |
 |
| Q |
292 |
t |
292 |
Q |
| |
|
| |
|
|
| T |
26801362 |
t |
26801362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University