View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16433_low_17 (Length: 252)
Name: NF16433_low_17
Description: NF16433
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16433_low_17 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 11 - 252
Target Start/End: Complemental strand, 46215559 - 46215318
Alignment:
| Q |
11 |
gagatgaagatgaaatattctctttgctttatgctgctaaattcatttttcatttttctttggtgatgaaagcgaaacaatggagtattttcgacccgtt |
110 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46215559 |
gagatgaagatgaaatattctctttgctt-atgctgctaaattcatttttcagttttctttggtgatgaaagcgaaacaatggagtattttcgacccgtt |
46215461 |
T |
|
| Q |
111 |
ttcactgtgtaaactaacaaactcattcatccattgtcttttcaccagnnnnnnnagagtagtttttgttacccgtgttaataataaacttttt-aagnn |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||| ||| |
|
|
| T |
46215460 |
ttcactgtgtaaactaacaaactcattcatccattgtcttttcaccagtttttttagagtagtttttgttacctgtgttaataataaacttttttaagaa |
46215361 |
T |
|
| Q |
210 |
nnnnncattggtaatagtagcatactacttttttcaatttatt |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46215360 |
aaaaacattggtaatagtagcatactacttttttcaatttatt |
46215318 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University