View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16433_low_22 (Length: 212)
Name: NF16433_low_22
Description: NF16433
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16433_low_22 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 129; Significance: 6e-67; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 68 - 200
Target Start/End: Complemental strand, 1188962 - 1188830
Alignment:
| Q |
68 |
ttttttggttagtctgatgatctttcaattgagcctgaattatcaaaataagatattgtgttttgaacaatagctcgaaatcttgaaccttggtttgtaa |
167 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
1188962 |
ttttttggttagtctgatgatctttcaattgagcctgaattatcaaaataagatattgtgttttgaacaatagctagaaatcttgaaccttggtttgtaa |
1188863 |
T |
|
| Q |
168 |
tatcaatggtttgtggttttccattctgtgctc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
1188862 |
tatcaatggtttgtggttttccattctgtgctc |
1188830 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 123 - 194
Target Start/End: Complemental strand, 1194471 - 1194400
Alignment:
| Q |
123 |
ttgtgttttgaacaatagctcgaaatcttgaaccttggtttgtaatatcaatggtttgtggttttccattct |
194 |
Q |
| |
|
|||||||| ||||||||||| ||||||||| ||||| ||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
1194471 |
ttgtgtttagaacaatagctagaaatcttggaccttagtttgtaatatcaatagtttgtggtattccattct |
1194400 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 154 - 194
Target Start/End: Complemental strand, 1183732 - 1183692
Alignment:
| Q |
154 |
accttggtttgtaatatcaatggtttgtggttttccattct |
194 |
Q |
| |
|
||||| ||||||||||||||| |||||||||||||| |||| |
|
|
| T |
1183732 |
accttagtttgtaatatcaatagtttgtggttttcctttct |
1183692 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000003; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 123 - 196
Target Start/End: Original strand, 5510464 - 5510537
Alignment:
| Q |
123 |
ttgtgttttgaacaatagctcgaaatcttgaaccttggtttgtaatatcaatggtttgtggttttccattctgt |
196 |
Q |
| |
|
|||||||||||| |||| || |||||| || ||||||||||||||||||| | |||||||||||| |||||| |
|
|
| T |
5510464 |
ttgtgttttgaataatatctagaaatcctggaccttggtttgtaatatcactaaattgtggttttcctttctgt |
5510537 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 144 - 174
Target Start/End: Complemental strand, 10204195 - 10204165
Alignment:
| Q |
144 |
gaaatcttgaaccttggtttgtaatatcaat |
174 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
10204195 |
gaaatcttgaaccttggtttgtaatatcaat |
10204165 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University